Enzymatic and molecular characterization of phytase producing yeasts isolated from soil in the Limpopo Province
Loading...
Date
Authors
Makhode, Matodzi Lizbeth
Journal Title
Journal ISSN
Volume Title
Publisher
Abstract
Twenty three phytase producing yeasts were isolated from soil in the Limpopo Province.
The Limpopo Province has been found to be an ideal source of yeast able to function at
high temperatures. The focus of this study was to profile the yeast isolates in terms of
their phytase activities in order to confirm and establish the organism with the highest
phytase activities. Three best phytase producing yeasts, HBD6.2, LD9 and LD7 were
selected for further studies and illustrated activities of 676.02, 630.21 and 440.94 U.ml-1,
respectively. HBD6.2, LD9 and LD7 were identified as Candida guilliermondii,
Candida diddensiae and Candida famata, respectively, using standard conventional
identification methods and PCR-RFLP was used to confirm the identities of these yeast
isolates. Six known yeast strains obtained from the yeast culture collection (University of
the Free State) were used as reference strains in the analysis. Pichia guilliermondii
Y0209, Pichia guilliermondii Y0053 and Pichia guilliermondii Y0054 were used as
reference strains for HBD6.2; Candida diddensiae for LD9; Debaryomyces hansenii
Y0210 and Debaryomyces hansenii Y0610 as the reference strains for LD7. Eleven
restriction digestion profiles used generated 84 markers with primers NS1 (5′
GTAGTCATATGCTTGTCTC 3′) and ITS2 (5′ GCTGCGTTCTTCATCGATGC 3′).
The similarity matrix was generated with the DICE coefficient using the NTSYS (pc)
program. The genetic distance between the taxa was used to generate a UPGMA
(unweighted pair group method using arithmetic averages) phylogenetic tree with a
bootstrap of 100 replications using the Treecon program. The three test yeasts did not
cluster with their reference strains, however, C. guilliermondii HBD6.2 clustered closely
with C. diddensiae Y0774 at a bootstrap value of 90 and have a similarity level of 100 %.
C. diddensiae LD9 and C. diddensiae Y0774 are both within the same cluster separated
by a bootstrap of 65, but shared a genetic similarity of 87 %. Candida famata LD7 was
found to be distantly related to all the yeast strains and it was only genetically similar to
its reference strains D. hansenii Y0209 and D. hansenii Y0610 at 51 % and 48 %,
respectively. To determine the optimal growth and enzyme activities, the three yeast
isolates were grown in PSM broth in shake flasks at temperature ranges of 25, 30 and 35º
C and the following pHs 4.0, 4.5, 5.0, 5.5 and 6.0, for each temperature. The optimum
growth temperature of the three test yeasts was 30º C for HBD6.2 at pH 5.5, LD9 at pH
VI
6.0, and LD7 at pH 5.5 or 6.0. The maximum enzyme activity was also obtained when
the organisms were grown at 30º C. Maximum enzyme activity for HBD6.2 and LD9
was reached at pH 5.0 or 6.0, LD7 at pH 5.5 or 6.0. Phytases from all three yeast isolates
were stable at 35º C, pH 5.5 for an average of 3 hrs retaining almost 80 % residual activity under these optimal conditions.
Description
Thesis (Microbiology)--University of Limpopo, 2008
